LiQuant™ Ultra Green qPCR Master Mix (500 rxns)
-26%

LiQuant™ Ultra Green qPCR Master Mix (500 rxns)

Cat. #: M0026-05
Availability: In Stock
Special price:$199.00
Old price:$269.00
You save:$70.00
-+
Key Features: 

• High specificity: High efficiency Taq antibodies and optimized buffer system greatly reduce the formation of primer dimers.  

• Super stable: The performance will not be decreased during storing and shipping.

• Wide dynamic range: Excellent repeatability over a wide dynamic range.

Description: LiQuant™ Ultra Green qPCR Master Mix is a Taq DNA polymerase-based 2× master mix for real time PCR, which contains all components, except for the primer. The master mix is applicable for intercalation assay with SYBR Green I and can be used in glass capillary systems or passive reference system. Hot Start technology with Taq polymerase antibodies enables high specificity and reproducible amplification. The specially optimized PCR buffer make the mix more efficient amplification of GC-rich templates and more stable at room temperature. According to the MIQE guidelines, a master mix should not have primer dimers amplification in NTC tests. This master mix greatly reduces the formation of primer dimers. Therefore, this premix makes qPCR primer design easier while meeting MIQE requirements.
Component: 1. LiQuant™ Ultra Green Master Mix: 5 ml
Storage:
This reagent can be stored at 2-8°C for 12 months and protected from light.
For longer storage, this reagent should be kept at -20°C and protected from light.
Other Size: LiQuant™ Ultra Green qPCR Master Mix (2000 rxns, $749)
Documents:
Manual
MSDS

Case Study

Green qPCR Master Mix

Figure 1. Comparison of the specificity between LiQuant™ Ultra and Brand N

Template DNA: Eight 10×Dilutes of the pET28a plasmid with Bacillus badius phenylalanine dehydrogenase gene.

Primer: Forward primer AGGAAGCCGATGTGTTCGTT        Reverse primer TTCCGCTTGCTGGTACACTT

From the melting curve, it shows that LiQuant™ Ultra exhibits a single peak under both low and high concentration templates, while under low concentration templates, Brand N exhibits non-specific amplification.


Green qPCR Master Mix

Figure 2. High stability verification

Template DNA: Eight 10×Dilutes of the pET28a plasmid with Bacillus badius phenylalanine dehydrogenase gene.

Primer: Forward primer AGGAAGCCGATGTGTTCGTT        Reverse primer TTCCGCTTGCTGGTACACTT

From the amplification curve, it shows that the LiQuant™ stored at 37 ℃ and at -20 ℃ have the same curve, and the Cq value is basically similar. From the standard curve, it shows that the PCR efficiency of LiQuant™ at different stored temperatures are both at 95% -100%, and the R2 value is 0.999.

Related Products


LifeSct © 2024

Publications

text_heading

Our Location

9610 Medical Center Drive, Suite 240, Rockville, MD 20850

1-240-715-2985

1-240-252-7376