LiQuant™ Ultra SYBR Green qPCR Master Mix is a ready-to-use 2× Taq DNA polymerase-based formulation optimized for real-time quantitative PCR. This SYBR Green master mix contains all reaction components except primers and templates, specifically engineered for intercalation-based detection with SYBR Green I. Compatible with both glass capillary systems and instruments requiring passive reference dyes, the SYBR qPCR mix integrates antibody-mediated HotStart technology to ensure high target specificity and reproducible amplification.
Key Features
• Enhanced Specificity: Proprietary Taq polymerase antibodies combined with an optimized buffer system minimize non-specific amplification, effectively suppressing primer dimer formation in No-Template Control (NTC) reactions to meet MIQE compliance standards.
• GC-Rich Template Efficiency: A uniquely balanced PCR buffer enables robust amplification of challenging GC-rich targets while maintaining thermal stability at room temperature.
• Transport-Stable Performance: Lyophilization-free formulation ensures uncompromised activity during extended storage and shipping cycles.
• Broad Dynamic Range: Delivers linear quantification across >8 orders of magnitude with intra-assay CV <1.5%.
Component
1. LiQuant™ Ultra SYBR Green qPCR Master Mix: 1 ml
Storage
Store at 2-8°C and protected from light.
Other Size
Product Name | Cat. # | Price | View |
LiQuant™ Ultra SYBR Green qPCR Master Mix (500 rxns) | M0026-05 | $359 | ![]() |
Case Study
Figure 1. Comparison of the specificity between LiQuant™ Ultra and Brand N
Template DNA: Eight 10×Dilutes of the pET28a plasmid with Bacillus badius phenylalanine dehydrogenase gene.
Primer: Forward primer AGGAAGCCGATGTGTTCGTT Reverse primer TTCCGCTTGCTGGTACACTT
From the melting curve, it shows that LiQuant™ Ultra exhibits a single peak under both low and high concentration templates, while under low concentration templates, Brand N exhibits non-specific amplification.
Figure 2. High stability verification
Template DNA: Eight 10×Dilutes of the pET28a plasmid with Bacillus badius phenylalanine dehydrogenase gene.
Primer: Forward primer AGGAAGCCGATGTGTTCGTT Reverse primer TTCCGCTTGCTGGTACACTT
From the amplification curve, it shows that the LiQuant™ stored at 37 ℃ and at -20 ℃ have the same curve, and the Cq value is basically similar. From the standard curve, it shows that the PCR efficiency of LiQuant™ at different stored temperatures are both at 95% -100%, and the R2 value is 0.999.
Publications
1. YAP/TEAD1 Complex Is a Default Repressor of Cardiac Toll-Like Receptor Genes.
Publication: International Journal of Molecular Sciences
2. Knockdown of lncRNA TP53TG1 Enhances the Efficacy of Sorafenib in Human Hepatocellular Carcinoma Cells.
Publication: non-coding RNA
3. Selectively expressing SARS-CoV-2 Spike protein S1 subunit in cardiomyocytes induces cardiac hypertrophy in mice.
Publication: bioRxiv